From f2dd39c0b3d52a302eda9b8e253fa896a29f81aa Mon Sep 17 00:00:00 2001 From: Aram Hedayati <48241209+aramhk@users.noreply.github.com> Date: Thu, 23 Mar 2023 12:28:41 +0100 Subject: [PATCH 1/2] Add files via upload --- Assignment 1.ipynb | 837 +++++++++++++++++++++++++++++++++++ Assignment 2.ipynb | 1049 ++++++++++++++++++++++++++++++++++++++++++++ Assignment 3.ipynb | 78 ++++ Assignment 4.ipynb | 355 +++++++++++++++ Assignment 5.ipynb | 198 +++++++++ Assignment 6.ipynb | 137 ++++++ 6 files changed, 2654 insertions(+) create mode 100644 Assignment 1.ipynb create mode 100644 Assignment 2.ipynb create mode 100644 Assignment 3.ipynb create mode 100644 Assignment 4.ipynb create mode 100644 Assignment 5.ipynb create mode 100644 Assignment 6.ipynb diff --git a/Assignment 1.ipynb b/Assignment 1.ipynb new file mode 100644 index 00000000..de969bc1 --- /dev/null +++ b/Assignment 1.ipynb @@ -0,0 +1,837 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "8e7c05fb", + "metadata": {}, + "source": [ + "## 1- Use the constructor methods" + ] + }, + { + "cell_type": "code", + "execution_count": 32, + "id": "20959727", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "20 \n", + "2.4 \n", + "Integrify-ML & DATA SCIENCE PROGRAM \n", + "['Python', 'C++', 'Java'] \n", + "('Python', 'C++', 'Java') \n", + "{'name': 'Aram', 'family': 'Hedayati', 'age': 39} \n", + "{3, 4, 5, 6} \n", + "True \n" + ] + } + ], + "source": [ + "#Use the constructor methods to create different data types in python(integer,float,string,list,tuple,dictionary,set etc.)\n", + "\n", + "a = int(20)\n", + "b = float(2.4)\n", + "c = str('Integrify-ML & DATA SCIENCE PROGRAM')\n", + "d = list(('Python', 'C++', 'Java'))\n", + "e = tuple(('Python', 'C++', 'Java'))\n", + "f = dict(name='Aram', family='Hedayati',age=39)\n", + "g = set((3, 4, 5, 6))\n", + "h = bool('True')\n", + "\n", + "\n", + "\n", + "print(a,type(a))\n", + "print(b,type(b))\n", + "print(c,type(c))\n", + "print(d,type(d))\n", + "print(e,type(e))\n", + "print(f,type(f))\n", + "print(g,type(g))\n", + "print(h,type(h))" + ] + }, + { + "cell_type": "code", + "execution_count": 33, + "id": "75a3e991", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n" + ] + } + ], + "source": [ + "#use object literals to create those data types.\n", + "\n", + "a1 = 20\n", + "b1 = 2.4\n", + "c1 = 'Integrify-ML & DATA SCIENCE PROGRAM'\n", + "d1 = ('Python', 'C++', 'Java')\n", + "e1 = ['Python', 'C++', 'Java']\n", + "f1 = {'name':'Aram', 'family':'Hedayati','age':39}\n", + "g1 = {3, 4, 5, 6}\n", + "h1 = True\n", + "\n", + "\n", + "print(type(a1))\n", + "print(type(b1))\n", + "print(type(c1))\n", + "print(type(d1))\n", + "print(type(e1))\n", + "print(type(f1))\n", + "print(type(g1))\n", + "print(type(h1))" + ] + }, + { + "cell_type": "markdown", + "id": "214b4c3b", + "metadata": {}, + "source": [ + "## 2- Operators in python " + ] + }, + { + "cell_type": "code", + "execution_count": 34, + "id": "d608ef56", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "12\n", + "-8\n", + "20\n", + "0.2\n", + "2\n", + "1024\n", + "0\n" + ] + } + ], + "source": [ + "#Create two operands and play around using different operators\n", + "\n", + "x=2\n", + "y=10\n", + "\n", + "#Arithmetic operators\n", + "\n", + "print(x+y)\n", + "print(x-y)\n", + "print(x*y)\n", + "print(x/y)\n", + "print(x%y)\n", + "print(x**y)\n", + "print(x//y)\n", + "\n" + ] + }, + { + "cell_type": "code", + "execution_count": 35, + "id": "e13a3e10", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "5\n", + "8\n", + "5\n", + "15\n", + "5.0\n", + "2.0\n", + "0.0\n", + "125\n", + "127\n", + "124\n", + "15\n", + "120\n" + ] + } + ], + "source": [ + "#Assignment Operators\n", + "\n", + "x=5\n", + "print(x)\n", + "\n", + "x += 3\n", + "print(x)\n", + "\n", + "x -= 3\n", + "print(x)\n", + "\n", + "x *= 3\n", + "print(x)\n", + "\n", + "x /= 3\n", + "print(x)\n", + "\n", + "x %= 3\n", + "print(x)\n", + "\n", + "x //= 3\n", + "print(x)\n", + "\n", + "x=5\n", + "\n", + "x **= 3\n", + "print(x)\n", + "\n", + "\n", + "x |= 3\n", + "print(x)\n", + "\n", + "x ^= 3\n", + "print(x)\n", + "\n", + "x >>= 3\n", + "print(x)\n", + "\n", + "x <<= 3\n", + "print(x)\n" + ] + }, + { + "cell_type": "code", + "execution_count": 36, + "id": "3b3283a4", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "False\n", + "True\n", + "True\n", + "False\n", + "True\n", + "False\n" + ] + } + ], + "source": [ + "#Comparison Operators\n", + "x = 5\n", + "y = 3\n", + "\n", + "print(x == y)\n", + "print(x != y)\n", + "print(x > y)\n", + "print(x < y)\n", + "print(x >= y)\n", + "print(x <= y)" + ] + }, + { + "cell_type": "code", + "execution_count": 37, + "id": "823901d7", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "True\n", + "False\n", + "True\n", + "True\n", + "False\n" + ] + } + ], + "source": [ + "x = [\"Python\", \"c++\"]\n", + "y = [\"Red\", \"Blue\"]\n", + "z = x\n", + "w = \"Python\"\n", + "\n", + "print(x is z)\n", + "print(x is y)\n", + "print(x == z)\n", + "\n", + "#Membership Operators\n", + "print(w in x)\n", + "print(w in y)" + ] + }, + { + "cell_type": "code", + "execution_count": 38, + "id": "fda402d3", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "8\n", + "11\n", + "3\n", + "-10\n" + ] + } + ], + "source": [ + "#Bitwise Operators\n", + "y=10\n", + "x=9\n", + "\n", + "print(x & y)\n", + "print(x | y)\n", + "print(x ^ y)\n", + "print(~x)\n" + ] + }, + { + "cell_type": "markdown", + "id": "1e737f71", + "metadata": {}, + "source": [ + "## 3- dir(object)" + ] + }, + { + "cell_type": "code", + "execution_count": 39, + "id": "dbce7316", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "['__abs__', '__add__', '__and__', '__bool__', '__ceil__', '__class__', '__delattr__', '__dir__', '__divmod__', '__doc__', '__eq__', '__float__', '__floor__', '__floordiv__', '__format__', '__ge__', '__getattribute__', '__getnewargs__', '__gt__', '__hash__', '__index__', '__init__', '__init_subclass__', '__int__', '__invert__', '__le__', '__lshift__', '__lt__', '__mod__', '__mul__', '__ne__', '__neg__', '__new__', '__or__', '__pos__', '__pow__', '__radd__', '__rand__', '__rdivmod__', '__reduce__', '__reduce_ex__', '__repr__', '__rfloordiv__', '__rlshift__', '__rmod__', '__rmul__', '__ror__', '__round__', '__rpow__', '__rrshift__', '__rshift__', '__rsub__', '__rtruediv__', '__rxor__', '__setattr__', '__sizeof__', '__str__', '__sub__', '__subclasshook__', '__truediv__', '__trunc__', '__xor__', 'as_integer_ratio', 'bit_length', 'conjugate', 'denominator', 'from_bytes', 'imag', 'numerator', 'real', 'to_bytes']\n", + "10\n", + "19\n", + "-38\n", + "-38\n", + "1\n", + "361\n" + ] + } + ], + "source": [ + "#int\n", + "a = int(5)\n", + "print(dir(a))\n", + "print(a.__add__(5))\n", + "\n", + "b=int(-19)\n", + "print(b.__abs__())\n", + "print(b.__mul__(2))\n", + "print(b.__mul__(2))\n", + "print(b.__mod__(2)) \n", + "print(b.__pow__(2))" + ] + }, + { + "cell_type": "code", + "execution_count": 40, + "id": "ec48da53", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "['__abs__', '__add__', '__bool__', '__ceil__', '__class__', '__delattr__', '__dir__', '__divmod__', '__doc__', '__eq__', '__float__', '__floor__', '__floordiv__', '__format__', '__ge__', '__getattribute__', '__getformat__', '__getnewargs__', '__gt__', '__hash__', '__init__', '__init_subclass__', '__int__', '__le__', '__lt__', '__mod__', '__mul__', '__ne__', '__neg__', '__new__', '__pos__', '__pow__', '__radd__', '__rdivmod__', '__reduce__', '__reduce_ex__', '__repr__', '__rfloordiv__', '__rmod__', '__rmul__', '__round__', '__rpow__', '__rsub__', '__rtruediv__', '__set_format__', '__setattr__', '__sizeof__', '__str__', '__sub__', '__subclasshook__', '__truediv__', '__trunc__', 'as_integer_ratio', 'conjugate', 'fromhex', 'hex', 'imag', 'is_integer', 'real']\n", + "6.0\n", + "0x1.91eb851eb851fp+1\n", + "0.28000000000000025\n", + "1.0\n", + "False\n" + ] + } + ], + "source": [ + "#float\n", + "c = float(3.14)\n", + "print(dir(c))\n", + "print(c.__add__(2.86))\n", + "print(c.hex())\n", + "print(c.__sub__(2.86))\n", + "print(c.__floordiv__(2))\n", + "print(c.is_integer())" + ] + }, + { + "cell_type": "code", + "execution_count": 41, + "id": "a484fd4d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "['__add__', '__class__', '__contains__', '__delattr__', '__dir__', '__doc__', '__eq__', '__format__', '__ge__', '__getattribute__', '__getitem__', '__getnewargs__', '__gt__', '__hash__', '__init__', '__init_subclass__', '__iter__', '__le__', '__len__', '__lt__', '__mod__', '__mul__', '__ne__', '__new__', '__reduce__', '__reduce_ex__', '__repr__', '__rmod__', '__rmul__', '__setattr__', '__sizeof__', '__str__', '__subclasshook__', 'capitalize', 'casefold', 'center', 'count', 'encode', 'endswith', 'expandtabs', 'find', 'format', 'format_map', 'index', 'isalnum', 'isalpha', 'isascii', 'isdecimal', 'isdigit', 'isidentifier', 'islower', 'isnumeric', 'isprintable', 'isspace', 'istitle', 'isupper', 'join', 'ljust', 'lower', 'lstrip', 'maketrans', 'partition', 'removeprefix', 'removesuffix', 'replace', 'rfind', 'rindex', 'rjust', 'rpartition', 'rsplit', 'rstrip', 'split', 'splitlines', 'startswith', 'strip', 'swapcase', 'title', 'translate', 'upper', 'zfill']\n", + "MachineLearning\n", + "7\n", + "Machine\n", + "MACHINE\n", + "1\n", + "['Mac', 'ine']\n", + "b'Machine'\n" + ] + } + ], + "source": [ + "#String\n", + "f = str('Machine')\n", + "print(dir(f))\n", + "print(f.__add__('Learning')) \n", + "\n", + "print(f.__len__())\n", + "print(f.capitalize())\n", + "print(f.upper())\n", + "print(f.count('h'))\n", + "print(f.split('h'))\n", + "print(f.encode()) " + ] + }, + { + "cell_type": "code", + "execution_count": 42, + "id": "d70a45df", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "['__add__', '__class__', '__class_getitem__', '__contains__', '__delattr__', '__delitem__', '__dir__', '__doc__', '__eq__', '__format__', '__ge__', '__getattribute__', '__getitem__', '__gt__', '__hash__', '__iadd__', '__imul__', '__init__', '__init_subclass__', '__iter__', '__le__', '__len__', '__lt__', '__mul__', '__ne__', '__new__', '__reduce__', '__reduce_ex__', '__repr__', '__reversed__', '__rmul__', '__setattr__', '__setitem__', '__sizeof__', '__str__', '__subclasshook__', 'append', 'clear', 'copy', 'count', 'extend', 'index', 'insert', 'pop', 'remove', 'reverse', 'sort']\n", + "[1, 2, 3, 4, 5]\n", + "3\n", + "2\n", + "True\n", + "True\n", + "True\n", + "[1, 2, 3, 4]\n" + ] + } + ], + "source": [ + "#list\n", + "g = list([1, 2, 3])\n", + "print(dir(g))\n", + "print(g.__add__([4, 5]))\n", + "\n", + "\n", + "print(g.__len__()) \n", + "print(g.__getitem__(1)) \n", + "print(g.__contains__(2)) \n", + "print(g.__eq__([1, 2, 3])) \n", + "print(g.__ne__([1, 2, 4])) \n", + "g.append(4)\n", + "print(g)" + ] + }, + { + "cell_type": "markdown", + "id": "417324b9", + "metadata": {}, + "source": [ + "## 4-Learn different ways to format the string. " + ] + }, + { + "cell_type": "code", + "execution_count": 43, + "id": "eae3c3cf", + "metadata": { + "scrolled": true + }, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "I love python\n", + "I love python\n", + "I love python version 3.1\n", + "I love python version 3.10\n", + "I love python version 3.10\n", + "I love python version 3.1\n", + "I love python version 3.10\n", + "I love python version 3.10\n", + "I love 3.10 version python\n", + "I love python version 3.10\n", + "I love python version 3.10\n", + "I love python version 3.10\n", + "I love python\n" + ] + } + ], + "source": [ + "#Learn different ways to format the string\n", + "print(\"I love\",\"python\")\n", + "print(\"I love\"+\" python\")\n", + "print(\"I love\"+\" python\"+\" version\",3.10)\n", + "print(\"I love\"+\" python\"+\" version %.2f\"%3.10)\n", + "print(\"I love %s version %.2f\"%(\"python\",3.10))\n", + "\n", + "#using foramt positional\n", + "print(\"I love {} version {}\".format(\"python\",3.10))\n", + "print(\"I love {} version {}\".format(\"python\",\"3.10\"))\n", + "print(\"I love {} version {:.2f}\".format(\"python\",3.10))\n", + "print(\"I love {1} version {0}\".format(\"python\",\"3.10\"))\n", + "\n", + "#using format keyword argument\n", + "print(\"I love {pl} version {version:.2f}\".format(pl=\"python\",version=3.10))\n", + "\n", + "#using f-string literal\n", + "info={\"pl\":\"python\",\"version\":3.10}\n", + "print(f\"I love {info.get('pl')} version {info.get('version'):.2f}\")\n", + "print(F'I love {info[\"pl\"]} version {info[\"version\"]:.2f}')\n", + "#F-string conditional\n", + "batch='ML'\n", + "print(f'I love {\"javascript\" if batch==\"FS\" else \"python\"}')" + ] + }, + { + "cell_type": "markdown", + "id": "18ecf4f7", + "metadata": {}, + "source": [ + "## 5- Familiarize yourself with indexing in python." + ] + }, + { + "cell_type": "code", + "execution_count": 46, + "id": "b25be4af", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "1\n", + "-------------------------------------------------------------------\n", + "['Sweden', 'Denmark', 'Netherlands', 'Germany', 'Norway', 'Iceland']\n", + "-------------------------------------------------------------------\n", + "['Finland', 'Sweden', 'Denmark', 'Netherlands', 'Germany', 'Norway']\n", + "-------------------------------------------------------------------\n", + "Iceland\n", + "-------------------------------------------------------------------\n", + "['Germany', 'Norway', 'Iceland']\n", + "-------------------------------------------------------------------\n", + "['Sweden', 'Netherlands', 'Norway']\n", + "-------------------------------------------------------------------\n", + "Finland Iceland\n", + "-------------------------------------------------------------------\n", + "['Netherlands', 'Germany', 'Norway']\n", + "-------------------------------------------------------------------\n", + "['Iceland', 'Norway', 'Germany', 'Netherlands', 'Denmark', 'Sweden', 'Finland']\n", + "-------------------------------------------------------------------\n", + "['Finland', 'Denmark', 'Germany', 'Iceland']\n", + "-------------------------------------------------------------------\n", + "['Norway', 'Netherlands', 'Sweden']\n", + "-------------------------------------------------------------------\n", + "[]\n", + "-------------------------------------------------------------------\n", + "['Germany', 'Netherlands', 'Denmark']\n", + "-------------------------------------------------------------------\n", + "0 Iceland\n", + "1 Norway\n", + "2 Germany\n", + "3 Netherlands\n", + "4 Denmark\n", + "5 Sweden\n", + "6 Finland\n" + ] + } + ], + "source": [ + "countries= [\"Finland\",\"Sweden\",\"Denmark\",\"Netherlands\",\"Germany\",\"Norway\",\"Iceland\"]\n", + "\n", + "#Find the index of “Sweden”\n", + "print(countries.index('Sweden'))\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Get all the items except the first\n", + "print(countries[1:])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Get all the items except the first\n", + "print(countries[:-1])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Find the last item using negative indexing\n", + "print(countries[-1])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Find the last three item using negative indexing\n", + "print(countries[-3:])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "#Grab all the items with odd indexes\n", + "print([countries[i] for i in range(len(countries)) if i % 2 == 1])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Find the first and last item for the list\n", + "print(countries[0],countries[-1])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Get [”Netherlands”,”Germany”,”Norway”] using negative indexing\n", + "print(countries[-4:-1])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Reverse the list\n", + "countries.reverse()\n", + "print(countries)\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#What is the output of countries[::-2]\n", + "print(countries[::-2])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#What is the output of countries[1:100:2]\n", + "print(countries[1:100:2])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "#What is the output of countries[len(countries)-1:0:2]\n", + "print(countries[len(countries)-1:0:2])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Get the output ['Germany', 'Netherlands', 'Denmark']\n", + "print(countries[2:5])\n", + "print('-------------------------------------------------------------------')\n", + "\n", + "\n", + "#Use enumerate method to get index and values in the list\n", + "for i, x in enumerate(countries):\n", + " print(i, x)\n" + ] + }, + { + "cell_type": "markdown", + "id": "b9e97dec", + "metadata": {}, + "source": [ + "## 6- Exercise on dictionaries" + ] + }, + { + "cell_type": "code", + "execution_count": 5, + "id": "75338ce7", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'a': 1, 'b': 2, 'c': 3, 'd': 4, 'e': 5}\n" + ] + } + ], + "source": [ + "# create a dictionary\n", + "a=[\"a\",\"b\",\"c\",\"d\",\"e\"]\n", + "b=[1,2,3,4,5]\n", + "mydic={}\n", + "\n", + "mydic = dict(zip(a, b))\n", + "print(mydic)" + ] + }, + { + "cell_type": "code", + "execution_count": 8, + "id": "3ae898f5", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'a': 1, 'b': 2, 'c': 3, 'd': 4, 'e': 5, 'f': 6, 'g': 7, 'h': 8}\n" + ] + } + ], + "source": [ + "#Create two dictionaries, merge them into one using update\n", + "\n", + "dic1={'a': 1, 'b': 2, 'c': 3, 'd': 4}\n", + "dic2={'e': 5, 'f': 6, 'g': 7, 'h': 8}\n", + "dic1.update(dic2)\n", + "print(dic1)" + ] + }, + { + "cell_type": "code", + "execution_count": 12, + "id": "029b744f", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'Duy': ['Python', 'Database', 'ML'], 'Laxmi': ['Python', 'Database', 'ML'], 'Antonio': ['Python', 'Database', 'ML'], 'Maria': ['Python', 'Database', 'ML']}\n" + ] + } + ], + "source": [ + "#Given the list of students, assign them the course\n", + "Students=[\"Duy\", \"Laxmi\",\"Antonio\",\"Maria\"]\n", + "Course1=[\"Python\",\"Database\",\"ML\"] \n", + "students_profile={}\n", + "for i in Students:\n", + " students_profile[i]=Course1\n", + " \n", + "print(students_profile)\n" + ] + }, + { + "cell_type": "code", + "execution_count": 13, + "id": "92632245", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'Duy': ['Python', 'Database', 'ML'], 'Laxmi': ['Python', 'Database', 'ML'], 'Antonio': ['JavaScript', 'Database', 'NodeJS'], 'Maria': ['Python', 'Database', 'ML']}\n" + ] + } + ], + "source": [ + "#Modify Antonio’s course to [\"JavaScript\",\"Database\",\"NodeJS\"]\n", + "students_profile['Antonio']=[\"JavaScript\",\"Database\",\"NodeJS\"]\n", + "print(students_profile)" + ] + }, + { + "cell_type": "code", + "execution_count": 15, + "id": "81730821", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'Duy': ['Python', 'Database', 'ML'], 'Laxmi': ['Python', 'Database', 'ML'], 'Antonio': ['JavaScript', 'Database', 'NodeJS', 'ReactJs', 'ReactJs'], 'Maria': ['Python', 'Database', 'ML']}\n" + ] + } + ], + "source": [ + "#Add “ReactJs” to Anonio’s course\n", + "students_profile['Antonio'].append(\"ReactJs\")\n", + "print(students_profile)" + ] + }, + { + "cell_type": "code", + "execution_count": 16, + "id": "44b4b318", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'Duy': ['Python', 'Database', 'ML'], 'Laxmi': ['Python', 'Database', 'ML'], 'Antonio': ['JavaScript', 'Database', 'NodeJS', 'Vuejs', 'Vuejs'], 'Maria': ['Python', 'Database', 'ML']}\n" + ] + } + ], + "source": [ + "#Replace Antonio’s “ReactJs” to “Vuejs”\n", + "students_profile['Antonio']= list(map(lambda x: x.replace('ReactJs', 'Vuejs'), students_profile['Antonio']))\n", + "print(students_profile)\n" + ] + }, + { + "cell_type": "code", + "execution_count": 22, + "id": "e39f0074", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'b': 2, 'c': 3, 'd': 4}\n", + "4\n", + "{'b': 2, 'c': 3}\n" + ] + } + ], + "source": [ + "#Remove an item from dictionary\n", + "dic1={'a': 1, 'b': 2, 'c': 3, 'd': 4}\n", + "del dic1['a']\n", + "print(dic1)\n", + "removed_dic = dic1.pop('d')\n", + "print(removed_dic)\n", + "print(dic1)\n", + "\n", + "#the pop() method returns the value of the key removed from a dictionary whereas del does not return any value" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "8e1c4ec9", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/Assignment 2.ipynb b/Assignment 2.ipynb new file mode 100644 index 00000000..f140d03d --- /dev/null +++ b/Assignment 2.ipynb @@ -0,0 +1,1049 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "fbda3f25", + "metadata": {}, + "source": [ + "# Python Basics: Flow Control, Loops, Functions\n" + ] + }, + { + "cell_type": "markdown", + "id": "fb7cc1ef", + "metadata": {}, + "source": [ + "#### 1) Get the radius value as input and calculate the area of the circle. If the input is numeric, display the result otherwise display any other message.\n" + ] + }, + { + "cell_type": "code", + "execution_count": 37, + "id": "77e6c5d0", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Pease enter radius?\n", + "5\n", + "78.57142857142857\n" + ] + } + ], + "source": [ + "#solution number1-using isnumeric function\n", + "\n", + "number = input('Pease enter radius?\\n')\n", + "\n", + "pi=22/7\n", + "\n", + "if number.isnumeric() == True:\n", + " radius=int(number)\n", + " area=radius*radius*pi\n", + " print(area)\n", + "else:\n", + " print('you didn''t enter a number')\n" + ] + }, + { + "cell_type": "code", + "execution_count": 39, + "id": "529abcb7", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Pease enter radius?\n", + "5\n", + "78.57142857142857\n" + ] + } + ], + "source": [ + "#solution number2- using try-except\n", + "try:\n", + " radius = float(input('Pease enter radius?\\n'))\n", + " pi=22/7\n", + " area=radius*radius*pi\n", + " print(area)\n", + " \n", + "except ValueError as err:\n", + " print('you didn''t enter a integer number')" + ] + }, + { + "cell_type": "markdown", + "id": "b39583b8", + "metadata": {}, + "source": [ + "#### 2) If the user enters numeric value then asks user to for either perimeter or area calculation and display accordingly" + ] + }, + { + "cell_type": "code", + "execution_count": 40, + "id": "83ccbefe", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Pease enter radius?\n", + "4\n", + "Select calculation type: Enter 1 for Area/ Enter 2 for perimeter: 1\n", + "50.285714285714285\n" + ] + } + ], + "source": [ + "\n", + "try:\n", + " radius = float(input('Pease enter radius?\\n'))\n", + " cal = \"\"\n", + " pi=22/7\n", + " while cal != \"1\" and cal != \"2\":\n", + " cal = input(\"Select calculation type: Enter 1 for Area/ Enter 2 for perimeter: \")\n", + " if cal != \"1\" and cal != \"2\":\n", + " print(\"Please Enter 1 or 2\")\n", + " if cal == \"1\":\n", + " area=radius*radius*pi\n", + " print(area)\n", + " else:\n", + " perimeter=2*pi*radius\n", + " print(perimeter)\n", + " \n", + "except ValueError as err:\n", + " print('you didn''t enter a number')\n", + "\n" + ] + }, + { + "cell_type": "markdown", + "id": "e94b12e6", + "metadata": {}, + "source": [ + "#### 4) students_profile" + ] + }, + { + "cell_type": "code", + "execution_count": 41, + "id": "b8aa9562", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "{'Duy': ['Python', 'Database', 'ML'], 'Laxmi': ['Python', 'Database', 'ML'], 'Antonio': ['Python', 'Database', 'ML'], 'Maria': ['Python', 'Database', 'ML']}\n", + "{'Duy': ['Python', 'Database'], 'Laxmi': ['Python', 'Database'], 'Antonio': ['Python', 'Database'], 'Maria': ['Python', 'Database']}\n" + ] + } + ], + "source": [ + "#Take the input from the user as a substring. If that substring is present in string then display substring is present otherwise substring is not present\n", + "Students=[\"Duy\", \"Laxmi\",\"Antonio\",\"Maria\"]\n", + "Course1=[\"Python\",\"Database\",\"ML\"] \n", + "students_profile={}\n", + "for i in Students:\n", + " students_profile[i]=Course1\n", + " \n", + "print(students_profile)\n", + "\n", + "name = students_profile.setdefault(\"Maria\")\n", + "if name!='':\n", + " students_profile['Maria'].remove('ML')\n", + "print(students_profile)\n" + ] + }, + { + "cell_type": "markdown", + "id": "a0831100", + "metadata": {}, + "source": [ + "#### Take the input from the user as a substring. If that substring is present in string then display substring is present otherwise substring is not present" + ] + }, + { + "cell_type": "code", + "execution_count": 42, + "id": "053c4954", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Please input a stringpython\n", + "python is present\n" + ] + } + ], + "source": [ + "str='I am doing python excercises'\n", + "substr = input(\"Please input a string\")\n", + "\n", + "if substr in str:\n", + " print(substr +' is present')\n", + "else:\n", + " print(substr +' is not present')" + ] + }, + { + "cell_type": "markdown", + "id": "fe0799f5", + "metadata": {}, + "source": [ + "#### Distance Metrics \n", + "Given the points (1,2,3) and (4,5,6), write a python conditional statement to print the distance for the order 1,2,3. If the order is 1 then it is **L1 norm(Manhattan distance)**, order 2 is **L2 norm(Euclidean distance)** and the generalized distance is given by **Minkowski equation**." + ] + }, + { + "cell_type": "code", + "execution_count": 46, + "id": "a917614f", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Select order type: Enter 1 for Manhattan distance/ Enter 2 for Euclidean distance/Enter 3 for Minkowski equation: 2\n", + "Euclidean distance:5.196152422706632\n" + ] + } + ], + "source": [ + "import math\n", + "from scipy.spatial import distance\n", + "\n", + "a = (1,2,3)\n", + "b = (4,5,6)\n", + "\n", + "order = input(\"Select order type: Enter 1 for Manhattan distance/ Enter 2 for Euclidean distance/Enter 3 for Minkowski equation: \")\n", + "while order != \"1\" and order != \"2\" and order!= \"3\":\n", + " order = input(\"Select order type: Enter 1 for Manhattan distance/ Enter 2 for Euclidean distance/Enter 3 for Minkowski equation: \")\n", + " if order!= \"1\" and order!= \"2\" and order!= \"3\":\n", + " print(\"Please Enter 1 or 2 or 3\")\n", + " \n", + "if order == \"1\":\n", + " md=sum([abs(i - j) for i, j in zip(a, b)])\n", + "\n", + " print(f'Manhattan distance:{md}') \n", + " \n", + "\n", + "elif order == \"2\":\n", + " ed=math.sqrt((a[0] - b[0])**2 + (a[1] - b[1])**2 + (a[2] - b[2])**2)\n", + " print(f'Euclidean distance:{ed}')\n", + " \n", + "elif order == \"3\":\n", + " me = distance.minkowski(a, b, p=3)\n", + " me2=((abs(a[0] - b[0])**3 + abs(a[1] - b[1])**3 + abs(a[2] - b[2])**3))**(1/3)\n", + " print(f'Minkowski equation(p=3):{me}')\n", + " print(f'Minkowski equation(p=3):{me2}')" + ] + }, + { + "cell_type": "markdown", + "id": "d3939b06", + "metadata": {}, + "source": [ + "#### Write a multiplication table for any given number using both for and while loop" + ] + }, + { + "cell_type": "code", + "execution_count": 47, + "id": "ee69f6dc", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Enter a number for multiplication: 5\n", + "5 x 1 = 5\n", + "5 x 2 = 10\n", + "5 x 3 = 15\n", + "5 x 4 = 20\n", + "5 x 5 = 25\n", + "5 x 6 = 30\n", + "5 x 7 = 35\n", + "5 x 8 = 40\n", + "5 x 9 = 45\n", + "5 x 10 = 50\n", + "-------------------------------\n", + "5 x 1 = 5\n", + "5 x 2 = 10\n", + "5 x 3 = 15\n", + "5 x 4 = 20\n", + "5 x 5 = 25\n", + "5 x 6 = 30\n", + "5 x 7 = 35\n", + "5 x 8 = 40\n", + "5 x 9 = 45\n", + "5 x 10 = 50\n" + ] + } + ], + "source": [ + "x = int(input(\"Enter a number for multiplication: \"))\n", + "\n", + "# Using for-loop\n", + "for i in range(1, 11):\n", + " print(f\"{x} x {i} = {x*i}\")\n", + "\n", + "print('-------------------------------')\n", + "# Using while-loop \n", + "i = 1\n", + "while i <= 10:\n", + " print(f\"{x} x {i} = {x*i}\")\n", + " i += 1\n" + ] + }, + { + "cell_type": "markdown", + "id": "064c8281", + "metadata": {}, + "source": [ + "#### DNA is coded using 4 nitrogen bases with the symbols A,T,G,C. Given the template string dna_template='AATCCGAAAATTCGGGAATTTTCGCGT' , generate the complementary dna template with the mapping" + ] + }, + { + "cell_type": "code", + "execution_count": 49, + "id": "a9974895", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "TTTGGGTTTTTTGGGGTTTTTTGGGGT\n" + ] + } + ], + "source": [ + "mapper = {\"T\": \"A\", \"A\": \"T\", \"G\": \"C\", \"C\": \"G\"}\n", + "\n", + "dna_template ='AATCCGAAAATTCGGGAATTTTCGCGT'\n", + "\n", + "for k,j in mapper.items():\n", + " dna_template= dna_template.replace(k,j)\n", + "print(dna_template)\n" + ] + }, + { + "cell_type": "markdown", + "id": "c0b2f00f", + "metadata": {}, + "source": [ + "#### Generate the list f_series=x=[0,1,1,2,3,5,8,13,21,34,55,89,144]. Looks Familiar? This is Fibonacci series where x[0]=0,x[1]=1, and x[n]=x[n-1]+x[n-2] for n>1" + ] + }, + { + "cell_type": "code", + "execution_count": 58, + "id": "30e31e1d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "0\n", + "1\n", + "1\n", + "2\n", + "3\n", + "5\n", + "8\n", + "13\n", + "21\n", + "34\n", + "55\n", + "89\n", + "144\n" + ] + } + ], + "source": [ + "def fibonacci(n):\n", + " \"\"\"\n", + " Computing the Fibonacci numbers:\n", + "\n", + " Parameters:\n", + " n (int): An integer greater than or equal to 0.\n", + "\n", + " Returns:\n", + " int: The n-th Fibonacci number.\n", + "\n", + " \"\"\"\n", + " if n <= 1:\n", + " return n\n", + " else:\n", + " return fibonacci(n-1) + fibonacci(n-2)\n", + "\n", + "for i in range(13):\n", + " print(fibonacci(i))" + ] + }, + { + "cell_type": "markdown", + "id": "8cf584ee", + "metadata": {}, + "source": [ + "#### Generate a list of n numbers of prime numbers" + ] + }, + { + "cell_type": "code", + "execution_count": 59, + "id": "0c52444a", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Please, Enter n: 10\n", + "The Prime Numbers are: \n", + "2\n", + "3\n", + "5\n", + "7\n" + ] + } + ], + "source": [ + "n = int(input (\"Please, Enter n: \"))\n", + "primes = []\n", + "print (\"The Prime Numbers are: \") \n", + "for num in range (2, n+ 1): \n", + " if num > 1: \n", + " for i in range (2, num): \n", + " if (num % i) == 0: \n", + " break \n", + " else: \n", + " print (num) " + ] + }, + { + "cell_type": "code", + "execution_count": 62, + "id": "0b98cb0d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Please, Enter n: 10\n", + "[2, 3, 5, 7, 11, 13, 17, 19, 23, 29]\n" + ] + } + ], + "source": [ + "def is_prime(num):\n", + " \"\"\"\n", + " Computing the prime numbers:\n", + "\n", + " Parameters:\n", + " n (int): An integer number.\n", + "\n", + " Returns:\n", + " bool: True if the number is prime, False if the number is not prime.\n", + "\n", + " \"\"\"\n", + " if num <= 1:\n", + " return False\n", + " for i in range(2, num):\n", + " if num % i == 0:\n", + " return False\n", + " return True\n", + "\n", + "def generate_primes(n):\n", + " \"\"\"\n", + " Computing the list of prime numbers\n", + " \n", + " Parameters:\n", + " n (int): An integer number.\n", + "\n", + " Returns:\n", + " print prime numbers between 2 to n\n", + " \n", + " \"\"\"\n", + " primes = []\n", + " i = 2\n", + " while len(primes) < n:\n", + " if is_prime(i):\n", + " primes.append(i)\n", + " i += 1\n", + " return primes\n", + "\n", + "\n", + "inp = int(input (\"Please, Enter n: \"))\n", + "print(generate_primes(inp))" + ] + }, + { + "cell_type": "markdown", + "id": "b821d852", + "metadata": {}, + "source": [ + "#### Perform the minmax normalization" + ] + }, + { + "cell_type": "code", + "execution_count": 63, + "id": "7ae65da3", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[0.0, 0.17582417582417584, 0.12087912087912088, 0.15384615384615385, 0.31868131868131866, 0.6483516483516484, 0.5164835164835165, 0.5494505494505495, 0.967032967032967, 1.0, 0.5824175824175825, 0.07692307692307693]\n", + "-------------------------------------------------\n", + "[-0.2962962962962963, 0.2592592592592593, 0.14814814814814814, 0.4444444444444444, 1.0, -1.0, 0.37037037037037046, 0.7407407407407407, -0.14814814814814814, 0.6666666666666667, 0.2962962962962963, 0.11111111111111116]\n" + ] + } + ], + "source": [ + "data1 = [1, 17, 12, 15, 30, 60, 48, 51, 89, 92, 54, 8]\n", + "X_min = min(data1)\n", + "X_max = max(data1)\n", + "data1_scaled = [(x - X_min) / (X_max - X_min) for x in data1]\n", + "print(data1_normalized)\n", + "\n", + "print('-------------------------------------------------')\n", + "\n", + "data2 = [-13, 2, -1, 7, 22, -32, 5, 15, -9, 13, 3, -2]\n", + "X_min = min(data2)\n", + "X_max = max(data2)\n", + "data2_scaled = [(2 * (x - X_min) / (X_max - X_min) - 1) for x in data2]\n", + "print(data2_scaled)" + ] + }, + { + "cell_type": "markdown", + "id": "03cd43e6", + "metadata": {}, + "source": [ + "#### Understand how sorting algorithms work(bubble,selection,insertion). Implement them of your own. Also compare time complexities." + ] + }, + { + "cell_type": "code", + "execution_count": 66, + "id": "82b734ff", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[10, 14, 18, 27, 33, 46, 85]\n" + ] + } + ], + "source": [ + "def bubble_sort(arr):\n", + " \"\"\"\n", + " Python function for implementation of Bubble Sort\n", + " \n", + " Parameters:\n", + " arr (array): list of unsorted number as a array.\n", + "\n", + " Returns:\n", + " arr(array): a sortet array\n", + " \"\"\" \n", + " n = len(arr)\n", + " for i in range(n):\n", + " for j in range(n-i-1):\n", + " if arr[j] > arr[j+1]:\n", + " arr[j], arr[j+1] = arr[j+1], arr[j]\n", + " return arr\n", + "\n", + "arr = [14, 46, 27, 10, 18, 85, 33]\n", + "sorted_arr = bubble_sort(arr)\n", + "print(sorted_arr)" + ] + }, + { + "cell_type": "code", + "execution_count": 67, + "id": "7eb0a21b", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[10, 14, 18, 27, 33, 46, 85]\n" + ] + } + ], + "source": [ + "def selection_sort(arr):\n", + " \"\"\"\n", + " Python function for implementation of Selection sort\n", + " \n", + " Parameters:\n", + " arr (array): list of unsorted number as a array.\n", + "\n", + " Returns:\n", + " arr(array): a sortet array\n", + " \"\"\" \n", + " n = len(arr)\n", + " for i in range(n):\n", + " min_idx = i\n", + " for j in range(i+1, n):\n", + " if arr[min_idx] > arr[j]:\n", + " min_idx = j\n", + " arr[i], arr[min_idx] = arr[min_idx], arr[i]\n", + " return arr\n", + "\n", + "arr = [14, 46, 27, 10, 18, 85, 33]\n", + "sorted_arr = selection_sort(arr)\n", + "print(sorted_arr)" + ] + }, + { + "cell_type": "code", + "execution_count": 33, + "id": "41819816", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[10, 14, 18, 27, 33, 46, 85]\n" + ] + } + ], + "source": [ + "def insertion_sort(arr):\n", + " \"\"\"\n", + " Python function for implementation of insertion sort\n", + " \n", + " Parameters:\n", + " arr (array): list of unsorted number as a array.\n", + "\n", + " Returns:\n", + " arr(array): a sortet array\n", + " \"\"\" \n", + " n = len(arr)\n", + " for i in range(1, n):\n", + " key = arr[i]\n", + " j = i-1\n", + " while j >=0 and key < arr[j] :\n", + " arr[j+1] = arr[j]\n", + " j -= 1\n", + " arr[j+1] = key\n", + " return arr\n", + "\n", + "arr = [14, 46, 27, 10, 18, 85, 33]\n", + "sorted_arr = insertion_sort(arr)\n", + "print(sorted_arr)" + ] + }, + { + "cell_type": "code", + "execution_count": 68, + "id": "65468235", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "\n", + " Python function for implementation of insertion sort\n", + " \n", + " Parameters:\n", + " arr (array): list of unsorted number as a array.\n", + "\n", + " Returns:\n", + " arr(array): a sortet array\n", + " \n" + ] + } + ], + "source": [ + "print(insertion_sort.__doc__)" + ] + }, + { + "cell_type": "markdown", + "id": "2df9e568", + "metadata": {}, + "source": [ + "#### Write a function factorial with docstrings" + ] + }, + { + "cell_type": "code", + "execution_count": 2, + "id": "010713a2", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "120\n" + ] + } + ], + "source": [ + "def factorial(n):\n", + " \"\"\"\n", + " Computing the factorial:\n", + "\n", + " Parameters:\n", + " n (int): A non-negative integer.\n", + "\n", + " Returns:\n", + " int: The factorial of n.\n", + "\n", + " \"\"\"\n", + " if n < 0:\n", + " raise ValueError(\"n must be a non-negative integer\")\n", + " elif n == 0:\n", + " return 1\n", + " else:\n", + " return n * factorial(n-1)\n", + "\n", + "print(factorial(5))" + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "id": "dc7d70a6", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "\n", + " Computing the factorial:\n", + "\n", + " Parameters:\n", + " n (int): A non-negative integer.\n", + "\n", + " Returns:\n", + " int: The factorial of n.\n", + "\n", + " \n" + ] + } + ], + "source": [ + "print(factorial.__doc__)\n", + "\n" + ] + }, + { + "cell_type": "markdown", + "id": "bba87d4f", + "metadata": {}, + "source": [ + "#### Implement for sigmoid, binary step function, relu, leaky rely, tanh" + ] + }, + { + "cell_type": "code", + "execution_count": 6, + "id": "7da8ede5", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Please Enter function name relu\n", + "Please Enter the value 5\n", + "5\n" + ] + } + ], + "source": [ + "import math\n", + "\n", + "def activation_fun(func_name, value):\n", + " value=int(value)\n", + " if func_name == \"sigmoid\":\n", + " return 1 / (1 + math.exp(value))\n", + " elif func_name == \"binary step\":\n", + " return 1 if value >= 0 else 0\n", + " elif func_name == \"relu\":\n", + " return max(0, value)\n", + " elif func_name == \"leaky relu\":\n", + " return max(0.01*value, value)\n", + " elif func_name == \"tanh\":\n", + " return math.tanh(value)\n", + " else:\n", + " raise ValueError(\"Invalid activation function name\")\n", + "\n", + "fun=(input (\"Please Enter function name \"))\n", + "val=(input (\"Please Enter the value \"))\n", + "print(activation_fun(fun, val))\n", + "\n" + ] + }, + { + "cell_type": "markdown", + "id": "10309846", + "metadata": {}, + "source": [ + "#### Write a function that returns permutation. Permutation is the number of ways to arrange 'r' objects form a set of 'n' objects where order matters and the formula is" + ] + }, + { + "cell_type": "code", + "execution_count": 8, + "id": "0030039d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "840.0\n" + ] + } + ], + "source": [ + "def permutation(n, r):\n", + " \"\"\"\n", + " This function returns the permutation of 'r' objects from a set of 'n' objects\n", + " \"\"\"\n", + " if n < r:\n", + " raise ValueError(\"n must be greater than or equal to r\")\n", + " else:\n", + " n1 = factorial(n)\n", + " n2 = factorial(n-r)\n", + " \n", + " return n1 / n2\n", + "\n", + "print(permutation(7, 4))" + ] + }, + { + "cell_type": "markdown", + "id": "83771b26", + "metadata": {}, + "source": [ + "#### Write a function that takes three arguments. First arguments should determine whether to return permutation or combination or both." + ] + }, + { + "cell_type": "code", + "execution_count": 14, + "id": "1f6b241c", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "210.0\n", + "10.0\n", + "6720.0\n", + "(90.0, 45.0)\n", + "(30240.0, 252.0)\n" + ] + } + ], + "source": [ + "def combination(n, r):\n", + " \"\"\"\n", + " This function returns the combination of 'r' objects from a set of 'n' objects\n", + " \"\"\"\n", + " if n < r:\n", + " raise ValueError(\"n must be greater than or equal to r\")\n", + " else:\n", + " n1 = factorial(n)\n", + " n2 = factorial(n-r)\n", + " r1=factorial(r)\n", + " \n", + " return n1 / (n2*r1)\n", + "\n", + "\n", + "def per_comb_both(args, n=10, r=5):\n", + " \"\"\"\n", + " This function returns the permutation and combination of 'r' objects from a set of 'n' objects.\n", + " \n", + " Parameters:\n", + " arg (str): select calculation type , can be permutation , combination or both\n", + " n(int):default 10\n", + " r(int):default 5\n", + "\n", + " Returns:\n", + " returns the permutation , combination or both base of first argument\n", + " \"\"\"\n", + " if args == 'permutation':\n", + " return permutation(n, r)\n", + " elif args == 'combination':\n", + " return combination(n, r)\n", + " elif args == 'both':\n", + " return (permutation(n, r), combination(n, r))\n", + " else:\n", + " raise ValueError(\"Choose permutation, combination, or both for the first argument\")\n", + " \n", + "print( per_comb_both('permutation',7, 3))\n", + "print( per_comb_both('combination', 5, 2))\n", + "print( per_comb_both('permutation', n=8))\n", + "print( per_comb_both('both', r=2))\n", + "print( per_comb_both('both'))" + ] + }, + { + "cell_type": "markdown", + "id": "f3f7b6ec", + "metadata": {}, + "source": [ + "#### Implement a function that takes any number of positional and keyword arguments." + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "id": "ffb9d5bb", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Hi, I am Prince\n", + "My age is 20\n", + "Hi, I am Prince\n", + "My age is 20\n", + "--------------------------\n", + "Case-1:\n", + "Hi, I am Prince\n", + "My age is 20\n", + "\n", + "Case-2:\n", + "Hi, I am 20\n", + "My age is Prince\n" + ] + } + ], + "source": [ + "#Keyword-Only Arguments\n", + "#we will call the function by using the keyword-only arguments in two ways and In both cases, we will be getting the correct output \n", + "def nameAge(name, age):\n", + " print(\"Hi, I am\", name)\n", + " print(\"My age is \", age)\n", + "\n", + "nameAge(name=\"Prince\", age=20)\n", + "nameAge(age=20, name=\"Prince\")\n", + "\n", + "print('--------------------------')\n", + "\n", + "def nameAge(name, age):\n", + " print(\"Hi, I am\", name)\n", + " print(\"My age is \", age)\n", + " \n", + "#Positional-Only Arguments\n", + "\n", + "#You will get correct output because argument is given in order\n", + "print(\"Case-1:\")\n", + "nameAge(\"Prince\", 20)\n", + "# You will get incorrect output because argument is not in order\n", + "print(\"\\nCase-2:\")\n", + "nameAge(20, \"Prince\")" + ] + }, + { + "cell_type": "markdown", + "id": "0e4ac288", + "metadata": {}, + "source": [ + "#### Understand scope of variables: LEGB Rule 1. Local to the function eg. variable defined in the function 2. Enclosing or nonlocal eg. variables defined in enclosing function in nested function 3. Global eg. variables defined within main program or module 4. Built-in eg. Python keyword" + ] + }, + { + "cell_type": "code", + "execution_count": 7, + "id": "6d78d68d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "Hello, John! I am learning Python.\n", + "6\n" + ] + } + ], + "source": [ + "# 'language' is a global variable defined outside of the function\n", + "# 'message' is a local variable within the greet() function.\n", + "# 'name' is an enclosing variable within the inner_greet() function. It can be accessed by the nested inner_greet() function\n", + "# 'len' is a built-in function that can be used from anywhere in the program.\n", + "\n", + "\n", + "\n", + "# Global variable\n", + "language = \"Python\"\n", + "\n", + "def greet():\n", + " # Local variable\n", + " message = \"Hello\"\n", + " \n", + " def inner_greet():\n", + " # Enclosing variable\n", + " name = \"John\"\n", + " print(f\"{message}, {name}! I am learning {language}.\")\n", + " \n", + " inner_greet()\n", + "\n", + "greet()\n", + "print(len(language))" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "44e6cdb4", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/Assignment 3.ipynb b/Assignment 3.ipynb new file mode 100644 index 00000000..eddf3612 --- /dev/null +++ b/Assignment 3.ipynb @@ -0,0 +1,78 @@ +{ + "cells": [ + { + "cell_type": "code", + "execution_count": 7, + "id": "dcb05413", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[1, 4, 9, 16, 25, 36, 49, 64, 81]\n", + "[2, 4, 6, 8]\n", + "384\n" + ] + } + ], + "source": [ + "from functools import reduce\n", + "\n", + "def square(x):\n", + " \"\"\" Return the squar of a number\"\"\"\n", + " return x**2\n", + "\n", + "\n", + "def product(x,y):\n", + " \"\"\" Return the product of two numbers\"\"\"\n", + " return x*y\n", + "\n", + "\n", + "if __name__=='__main__':\n", + " numbers=[1,2,3,4,5,6,7,8,9]\n", + " \n", + " #using map() to square each elemnt of the list\n", + " squares=list(map(square,numbers))\n", + " print(squares)\n", + " \n", + " #using filter() to remove odd numbers from the list\n", + " evens=list(filter(lambda x:x%2==0,numbers))\n", + " print(evens)\n", + " \n", + " #using reduce to find the product of all even numbers in the list\n", + " product=reduce(product,evens)\n", + " print(product)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "a242c33d", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/Assignment 4.ipynb b/Assignment 4.ipynb new file mode 100644 index 00000000..4cd5b6cc --- /dev/null +++ b/Assignment 4.ipynb @@ -0,0 +1,355 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "cc90a687", + "metadata": {}, + "source": [ + "#### Create a list apply iter method to it and run next method until you get StopIteration error" + ] + }, + { + "cell_type": "code", + "execution_count": 1, + "id": "91510118", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "1\n", + "2\n", + "3\n", + "4\n", + "5\n" + ] + }, + { + "ename": "StopIteration", + "evalue": "", + "output_type": "error", + "traceback": [ + "\u001b[1;31m---------------------------------------------------------------------------\u001b[0m", + "\u001b[1;31mStopIteration\u001b[0m Traceback (most recent call last)", + "Input \u001b[1;32mIn [1]\u001b[0m, in \u001b[0;36m\u001b[1;34m()\u001b[0m\n\u001b[0;32m 19\u001b[0m element \u001b[38;5;241m=\u001b[39m \u001b[38;5;28mnext\u001b[39m(my_iter)\n\u001b[0;32m 20\u001b[0m \u001b[38;5;28mprint\u001b[39m(element)\n\u001b[1;32m---> 22\u001b[0m element \u001b[38;5;241m=\u001b[39m \u001b[38;5;28;43mnext\u001b[39;49m\u001b[43m(\u001b[49m\u001b[43mmy_iter\u001b[49m\u001b[43m)\u001b[49m\n\u001b[0;32m 23\u001b[0m \u001b[38;5;28mprint\u001b[39m(element)\n", + "\u001b[1;31mStopIteration\u001b[0m: " + ] + } + ], + "source": [ + "# create a list of integers\n", + "my_list = [1, 2, 3, 4, 5]\n", + "\n", + "# create an iterator from the list\n", + "my_iter = iter(my_list)\n", + "\n", + "element = next(my_iter)\n", + "print(element)\n", + "\n", + "element = next(my_iter)\n", + "print(element)\n", + "\n", + "element = next(my_iter)\n", + "print(element)\n", + "\n", + "element = next(my_iter)\n", + "print(element)\n", + "\n", + "element = next(my_iter)\n", + "print(element)\n", + "\n", + "element = next(my_iter)\n", + "print(element)" + ] + }, + { + "cell_type": "markdown", + "id": "ba85172a", + "metadata": {}, + "source": [ + "#### Import itertools in your notebook and create infinite iterators using count,cycle and and repeat methods." + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "bae9fcd7", + "metadata": {}, + "outputs": [], + "source": [ + "import itertools\n", + "\n", + "#for num in itertools.count(start=1, step=2):\n", + "# print(num)\n", + "\n", + "\n", + "#my_list = [1, 2, 3]\n", + "#for num in itertools.cycle(my_list):\n", + "# print(num)\n", + " \n", + " \n", + "#for num in itertools.repeat(5):\n", + "# print(num)\n", + "\n" + ] + }, + { + "cell_type": "markdown", + "id": "2c9f08be", + "metadata": {}, + "source": [ + "#### Use methods from Iterators terminating on the shortest input sequence" + ] + }, + { + "cell_type": "code", + "execution_count": 4, + "id": "0a70ce15", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "The sum after each iteration is : [1, 5, 10, 17]\n", + "The product after each iteration is : [1, 4, 20, 140]\n" + ] + } + ], + "source": [ + "import itertools\n", + "import operator\n", + " \n", + "# initializing list 1\n", + "li1 = [1, 4, 5, 7]\n", + " \n", + "# using accumulate()\n", + "# prints the successive summation of elements\n", + "print (\"The sum after each iteration is : \", end =\"\")\n", + "print (list(itertools.accumulate(li1)))\n", + " \n", + "# using accumulate()\n", + "# prints the successive multiplication of elements\n", + "print (\"The product after each iteration is : \", end =\"\")\n", + "print (list(itertools.accumulate(li1, operator.mul)))" + ] + }, + { + "cell_type": "markdown", + "id": "e0c157a6", + "metadata": {}, + "source": [ + "#### Create an infinite generator that generates the fibonacci series" + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "id": "8c979641", + "metadata": {}, + "outputs": [], + "source": [ + "def fibonacci():\n", + " a, b = 0, 1\n", + " while True:\n", + " yield a\n", + " a, b = b, a + b" + ] + }, + { + "cell_type": "markdown", + "id": "2ef2c8ad", + "metadata": {}, + "source": [ + "#### Comprehension\n" + ] + }, + { + "cell_type": "code", + "execution_count": 5, + "id": "1a1dcef1", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[5, 10, 15, 20, 25, 30, 35, 40, 45, 50]\n" + ] + } + ], + "source": [ + "#Write a multiplication table of any given number in a list using list comprehension\n", + "num = 5\n", + "table = [num * i for i in range(1, 11)]\n", + "print(table)" + ] + }, + { + "cell_type": "code", + "execution_count": 6, + "id": "b89e98f5", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[5, 15, 25, 35, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 65, 75, 85, 95, 105, 115, 125, 135, 145, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 165, 175, 185, 195, 205, 215, 225, 235, 245, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 265, 275, 285, 295, 305, 315, 325, 335, 345, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 365, 375, 385, 395, 405, 415, 425, 435, 445, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 465, 475, 485, 495, 500]\n" + ] + } + ], + "source": [ + "#Find all numbers from 1 to 500 that has 5 in them\n", + "\n", + "numbers = [num for num in range(1, 501) if '5' in str(num)]\n", + "print(numbers)" + ] + }, + { + "cell_type": "code", + "execution_count": 7, + "id": "86ed145d", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[True, 10, 20, 30, 4.0, False, 0]\n" + ] + } + ], + "source": [ + "#Given the list of items=[\"apple\",True,10,\"banana\",20,30,4.0,\"grapes\",\"laptop\",\"phone\", False,0], generate the list of non-string values\n", + "\n", + "my_list = [\"apple\", True, 10, \"banana\", 20, 30, 4.0, \"grapes\", \"laptop\", \"phone\", False, 0]\n", + "non_strings = [item for item in my_list if not isinstance(item, str)]\n", + "print(non_strings)" + ] + }, + { + "cell_type": "code", + "execution_count": 9, + "id": "bc3b9154", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[False, True, True, False, True, True, True, False, False, False, True, True]\n" + ] + } + ], + "source": [ + "#Generate the boolean True for numeric and False for non-numeric in above items list\n", + "numeric = [isinstance(item, (int, float)) for item in my_list]\n", + "print(numeric)" + ] + }, + { + "cell_type": "markdown", + "id": "d0cd5e15", + "metadata": {}, + "source": [ + "#files=[\"cat1.png\",\"dog1.png\",\"cat2.png\",\"cat3.png\",\"cat4.png\",\"dog2.png\",\"cat5.png\",\"cat6.png\",\"dog3.png\"],\n", + "generate two lists of cat and dog image files" + ] + }, + { + "cell_type": "code", + "execution_count": 10, + "id": "35be608c", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "['cat1.png', 'cat2.png', 'cat3.png', 'cat4.png', 'cat5.png', 'cat6.png']\n", + "['dog1.png', 'dog2.png', 'dog3.png']\n" + ] + } + ], + "source": [ + "files = [\"cat1.png\", \"dog1.png\", \"cat2.png\", \"cat3.png\", \"cat4.png\", \"dog2.png\", \"cat5.png\", \"cat6.png\", \"dog3.png\"]\n", + "cats = [item for item in files if \"cat\" in item]\n", + "dogs = [item for item in files if \"dog\" in item]\n", + "print(cats)\n", + "print(dogs)" + ] + }, + { + "cell_type": "markdown", + "id": "d554d65a", + "metadata": {}, + "source": [ + "#### Run the following command in your notebook. What could be the reason the list comprehension is more elegant?\n" + ] + }, + { + "cell_type": "code", + "execution_count": 14, + "id": "64c333e7", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "for loop time:_ 2.6864099502563477\n", + "List comprehension time: 2.2128942012786865\n" + ] + } + ], + "source": [ + "import time\n", + "\n", + "start_time=time.time()\n", + "nums=[]\n", + "for i in range(1,10000001):\n", + " nums.append(i**2)\n", + "end_time=time.time()\n", + "for_loop_time=end_time-start_time\n", + "\n", + "start_time=time.time()\n", + "nums=[i**2 for i in range(1,10000001)]\n", + "end_time=time.time()\n", + "list_comp_time=end_time-start_time\n", + "print(\"for loop time:_\",for_loop_time)\n", + "print(\"List comprehension time:\",list_comp_time)\n" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "de9a04ec", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/Assignment 5.ipynb b/Assignment 5.ipynb new file mode 100644 index 00000000..c5193277 --- /dev/null +++ b/Assignment 5.ipynb @@ -0,0 +1,198 @@ +{ + "cells": [ + { + "cell_type": "code", + "execution_count": 4, + "id": "c7c8fa9c", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + " \n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n" + ] + } + ], + "source": [ + "a=5\n", + "b=\"some string\"\n", + "print(type(a),type(b))\n", + "\n", + "def someFunction():\n", + " return\n", + "\n", + "class Someclass():\n", + " pass\n", + "\n", + "someList=[int,str,tuple,dict,list,print,someFunction,Someclass]\n", + "for item in someList:\n", + " print(type(item))" + ] + }, + { + "cell_type": "code", + "execution_count": 7, + "id": "767055d8", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n", + "\n" + ] + } + ], + "source": [ + "anotherList=[int(),str(),tuple(),dict(),list(),print(),someFunction(),Someclass()]\n", + "for item in anotherList:\n", + " print(type(item))" + ] + }, + { + "cell_type": "markdown", + "id": "7459f7f9", + "metadata": {}, + "source": [ + "#### Create two classes Pet and Dog " + ] + }, + { + "cell_type": "code", + "execution_count": 11, + "id": "52a07a28", + "metadata": {}, + "outputs": [], + "source": [ + "\n", + "from datetime import date\n", + "\n", + "class Pet():\n", + " pet_population = 0\n", + " pet_instance = []\n", + " current_year=date.today().year\n", + " \n", + " def __init__(self,name,category,age):\n", + " self.name=name\n", + " self.category=category\n", + " self.age=age\n", + " Pet.pet_population += 1\n", + " Pet.pet_instance.append(self)\n", + " \n", + " def hellofrompet(self):\n", + " print(\"Hello from\", self.name)\n", + " \n", + " @classmethod\n", + " def timepassedby(cls, years):\n", + " for pet in cls.pet_instance:\n", + " pet.age += years\n", + " \n", + "class Dog(Pet):\n", + " def __init__(self, name, age, breed):\n", + " super().__init__(name, \"Dog\", age)\n", + " self.breed = breed\n", + "\n", + " def barks(self):\n", + " print(f\"{self.breed} does woof woof.\")\n", + " \n", + "\n", + " " + ] + }, + { + "cell_type": "code", + "execution_count": 18, + "id": "7a8c69e0", + "metadata": {}, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "13\n", + "13\n", + "Micky\n", + "Micky\n", + "Saphie\n", + "Micky\n", + "Saphie\n", + "Micky\n", + "Saphie\n", + "Micky\n", + "Saphie\n", + "Micky\n", + "Saphie\n", + "Micky\n", + "Saphie\n", + "6\n", + "7\n", + "German Shepherd does woof woof.\n" + ] + } + ], + "source": [ + "instance1=Pet(\"Micky\",\"Cat\",1)\n", + "instance2=Dog(\"Saphie\",2,\"German Shepherd\")\n", + "\n", + "print(Pet.pet_population)\n", + "print(Dog.pet_population)\n", + "\n", + "for item in Pet.pet_instance:\n", + " print(item.name)\n", + " \n", + "Pet.timepassedby(5)\n", + "print(instance1.age)\n", + "print(instance2.age)\n", + "\n", + "#instance1.barks()\n", + "instance2.barks()\n" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "661d3d9a", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/Assignment 6.ipynb b/Assignment 6.ipynb new file mode 100644 index 00000000..020dbe42 --- /dev/null +++ b/Assignment 6.ipynb @@ -0,0 +1,137 @@ +{ + "cells": [ + { + "cell_type": "code", + "execution_count": 1, + "id": "9b1b5b29", + "metadata": {}, + "outputs": [], + "source": [ + "# help to suggest commands and functions\n", + "%config completer.use_jedi=False " + ] + }, + { + "cell_type": "code", + "execution_count": 9, + "id": "a87bec83", + "metadata": {}, + "outputs": [ + { + "name": "stderr", + "output_type": "stream", + "text": [ + "E\n", + "======================================================================\n", + "ERROR: C:\\Users\\aramk\\AppData\\Roaming\\jupyter\\runtime\\kernel-421b2065-217c-4e78-a823-da83f4b6ebfe (unittest.loader._FailedTest)\n", + "----------------------------------------------------------------------\n", + "AttributeError: module '__main__' has no attribute 'C:\\Users\\aramk\\AppData\\Roaming\\jupyter\\runtime\\kernel-421b2065-217c-4e78-a823-da83f4b6ebfe'\n", + "\n", + "----------------------------------------------------------------------\n", + "Ran 1 test in 0.002s\n", + "\n", + "FAILED (errors=1)\n" + ] + }, + { + "ename": "SystemExit", + "evalue": "True", + "output_type": "error", + "traceback": [ + "An exception has occurred, use %tb to see the full traceback.\n", + "\u001b[1;31mSystemExit\u001b[0m\u001b[1;31m:\u001b[0m True\n" + ] + }, + { + "name": "stderr", + "output_type": "stream", + "text": [ + "c:\\users\\aramk\\appdata\\local\\programs\\python\\python39\\lib\\site-packages\\IPython\\core\\interactiveshell.py:3406: UserWarning: To exit: use 'exit', 'quit', or Ctrl-D.\n", + " warn(\"To exit: use 'exit', 'quit', or Ctrl-D.\", stacklevel=1)\n" + ] + } + ], + "source": [ + "import unittest\n", + "\n", + "def is_prime(n):\n", + " if n <= 1:\n", + " return False\n", + " for i in range(2, int(n**0.5) + 1):\n", + " if n % i == 0:\n", + " return False\n", + " return True\n", + "\n", + "class TestIsPrime(unittest.TestCase): \n", + " \n", + " def test_negative(self):\n", + " self.assertFalse(is_prime(-10))\n", + " self.assertFalse(is_prime(-1))\n", + " self.assertFalse(is_prime(-100))\n", + " \n", + " def test_zero_and_one(self):\n", + " self.assertFalse(is_prime(0))\n", + " self.assertFalse(is_prime(1)) \n", + " \n", + " def test_small_primes(self):\n", + " self.assertTrue(is_prime(2))\n", + " self.assertTrue(is_prime(3))\n", + " self.assertTrue(is_prime(5))\n", + " self.assertTrue(is_prime(7))\n", + "\n", + " def test_large_primes(self):\n", + " self.assertTrue(is_prime(103))\n", + " self.assertTrue(is_prime(107))\n", + " self.assertTrue(is_prime(109))\n", + " \n", + " def test_small_composites(self):\n", + " self.assertFalse(is_prime(4))\n", + " self.assertFalse(is_prime(6))\n", + " self.assertFalse(is_prime(8))\n", + " self.assertFalse(is_prime(9))\n", + " \n", + " def test_large_composites(self):\n", + " self.assertFalse(is_prime(100))\n", + " self.assertFalse(is_prime(200))\n", + " self.assertFalse(is_prime(300)) \n", + " \n", + " def test_large_composites(self):\n", + " self.assertFalse(is_prime(100))\n", + " self.assertFalse(is_prime(200))\n", + " self.assertFalse(is_prime(300)) \n", + "\n", + "if __name__ == '__main__':\n", + " unittest.main()" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "da8d82eb", + "metadata": {}, + "outputs": [], + "source": [] + } + ], + "metadata": { + "kernelspec": { + "display_name": "Python 3 (ipykernel)", + "language": "python", + "name": "python3" + }, + "language_info": { + "codemirror_mode": { + "name": "ipython", + "version": 3 + }, + "file_extension": ".py", + "mimetype": "text/x-python", + "name": "python", + "nbconvert_exporter": "python", + "pygments_lexer": "ipython3", + "version": "3.9.0" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} From 28bd1d72a359f8d207c149cd5c1a58d9b2fedca4 Mon Sep 17 00:00:00 2001 From: Aram Hedayati <48241209+aramhk@users.noreply.github.com> Date: Tue, 1 Apr 2025 02:05:24 +0200 Subject: [PATCH 2/2] Created using Colab --- course/en/chapter1/section3.ipynb | 358 ++++++++++++++++++++++++++++++ 1 file changed, 358 insertions(+) create mode 100644 course/en/chapter1/section3.ipynb diff --git a/course/en/chapter1/section3.ipynb b/course/en/chapter1/section3.ipynb new file mode 100644 index 00000000..2162fbd3 --- /dev/null +++ b/course/en/chapter1/section3.ipynb @@ -0,0 +1,358 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "metadata": { + "id": "ut240b08p_NT" + }, + "source": [ + "# Transformers, what can they do?" + ] + }, + { + "cell_type": "markdown", + "metadata": { + "id": "-2-J6glip_NW" + }, + "source": [ + "Install the Transformers, Datasets, and Evaluate libraries to run this notebook." + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "z3qewYqDp_NW" + }, + "outputs": [], + "source": [ + "!pip install datasets evaluate transformers[sentencepiece]" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "XKe58rIqp_NX", + "outputId": "ca0cffa7-9aa4-42f4-ab5d-72606979bfcb" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'label': 'POSITIVE', 'score': 0.9598047137260437}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "classifier = pipeline(\"sentiment-analysis\")\n", + "classifier(\"I've been waiting for a HuggingFace course my whole life.\")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "KbpUw6tSp_NY", + "outputId": "5cd93bf9-e5a0-4a63-d745-72a3cdf4cf93" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'label': 'POSITIVE', 'score': 0.9598047137260437},\n", + " {'label': 'NEGATIVE', 'score': 0.9994558095932007}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "classifier(\n", + " [\"I've been waiting for a HuggingFace course my whole life.\", \"I hate this so much!\"]\n", + ")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "uZuPzpnTp_NY", + "outputId": "3194bb3f-1cb6-46c0-ac04-a3fffc76d5ff" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "{'sequence': 'This is a course about the Transformers library',\n", + " 'labels': ['education', 'business', 'politics'],\n", + " 'scores': [0.8445963859558105, 0.111976258456707, 0.043427448719739914]}" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "classifier = pipeline(\"zero-shot-classification\")\n", + "classifier(\n", + " \"This is a course about the Transformers library\",\n", + " candidate_labels=[\"education\", \"politics\", \"business\"],\n", + ")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "X79PHO4sp_NY", + "outputId": "ef1f8537-b715-4eca-f6a0-de34a66fbb0a" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'generated_text': 'In this course, we will teach you how to understand and use '\n", + " 'data flow and data interchange when handling user data. We '\n", + " 'will be working with one or more of the most commonly used '\n", + " 'data flows — data flows of various types, as seen by the '\n", + " 'HTTP'}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "generator = pipeline(\"text-generation\")\n", + "generator(\"In this course, we will teach you how to\")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "s1hR7BhMp_NZ", + "outputId": "23d8835f-0bd7-4052-f712-1f4e169a0f44" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'generated_text': 'In this course, we will teach you how to manipulate the world and '\n", + " 'move your mental and physical capabilities to your advantage.'},\n", + " {'generated_text': 'In this course, we will teach you how to become an expert and '\n", + " 'practice realtime, and with a hands on experience on both real '\n", + " 'time and real'}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "generator = pipeline(\"text-generation\", model=\"distilgpt2\")\n", + "generator(\n", + " \"In this course, we will teach you how to\",\n", + " max_length=30,\n", + " num_return_sequences=2,\n", + ")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "d11hq0tlp_NZ", + "outputId": "60691b30-a4bc-455a-b5af-c242466319c6" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'sequence': 'This course will teach you all about mathematical models.',\n", + " 'score': 0.19619831442832947,\n", + " 'token': 30412,\n", + " 'token_str': ' mathematical'},\n", + " {'sequence': 'This course will teach you all about computational models.',\n", + " 'score': 0.04052725434303284,\n", + " 'token': 38163,\n", + " 'token_str': ' computational'}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "unmasker = pipeline(\"fill-mask\")\n", + "unmasker(\"This course will teach you all about models.\", top_k=2)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "mtjlpOF2p_NZ", + "outputId": "f155cb28-d585-47d5-fb2f-f8a51b8b0f99" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'entity_group': 'PER', 'score': 0.99816, 'word': 'Sylvain', 'start': 11, 'end': 18}, \n", + " {'entity_group': 'ORG', 'score': 0.97960, 'word': 'Hugging Face', 'start': 33, 'end': 45}, \n", + " {'entity_group': 'LOC', 'score': 0.99321, 'word': 'Brooklyn', 'start': 49, 'end': 57}\n", + "]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "ner = pipeline(\"ner\", grouped_entities=True)\n", + "ner(\"My name is Sylvain and I work at Hugging Face in Brooklyn.\")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "WLaWIxqCp_NZ", + "outputId": "ef501596-9ca7-4263-f4c1-3e5e34433643" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "{'score': 0.6385916471481323, 'start': 33, 'end': 45, 'answer': 'Hugging Face'}" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "question_answerer = pipeline(\"question-answering\")\n", + "question_answerer(\n", + " question=\"Where do I work?\",\n", + " context=\"My name is Sylvain and I work at Hugging Face in Brooklyn\",\n", + ")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "_ocNNrLtp_Na", + "outputId": "4bc0b405-1ccc-4069-d1d9-d0f1e5631bf3" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'summary_text': ' America has changed dramatically during recent years . The '\n", + " 'number of engineering graduates in the U.S. has declined in '\n", + " 'traditional engineering disciplines such as mechanical, civil '\n", + " ', electrical, chemical, and aeronautical engineering . Rapidly '\n", + " 'developing economies such as China and India, as well as other '\n", + " 'industrial countries in Europe and Asia, continue to encourage '\n", + " 'and advance engineering .'}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "summarizer = pipeline(\"summarization\")\n", + "summarizer(\n", + " \"\"\"\n", + " America has changed dramatically during recent years. Not only has the number of\n", + " graduates in traditional engineering disciplines such as mechanical, civil,\n", + " electrical, chemical, and aeronautical engineering declined, but in most of\n", + " the premier American universities engineering curricula now concentrate on\n", + " and encourage largely the study of engineering science. As a result, there\n", + " are declining offerings in engineering subjects dealing with infrastructure,\n", + " the environment, and related issues, and greater concentration on high\n", + " technology subjects, largely supporting increasingly complex scientific\n", + " developments. While the latter is important, it should not be at the expense\n", + " of more traditional engineering.\n", + "\n", + " Rapidly developing economies such as China and India, as well as other\n", + " industrial countries in Europe and Asia, continue to encourage and advance\n", + " the teaching of engineering. Both China and India, respectively, graduate\n", + " six and eight times as many traditional engineers as does the United States.\n", + " Other industrial countries at minimum maintain their output, while America\n", + " suffers an increasingly serious decline in the number of engineering graduates\n", + " and a lack of well-educated engineers.\n", + "\"\"\"\n", + ")" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "metadata": { + "id": "0ZAGob6Wp_Na", + "outputId": "69f55091-569f-4058-f542-ffe6cb754f37" + }, + "outputs": [ + { + "data": { + "text/plain": [ + "[{'translation_text': 'This course is produced by Hugging Face.'}]" + ] + }, + "execution_count": null, + "metadata": {}, + "output_type": "execute_result" + } + ], + "source": [ + "from transformers import pipeline\n", + "\n", + "translator = pipeline(\"translation\", model=\"Helsinki-NLP/opus-mt-fr-en\")\n", + "translator(\"Ce cours est produit par Hugging Face.\")" + ] + } + ], + "metadata": { + "colab": { + "name": "Transformers, what can they do?", + "provenance": [] + } + }, + "nbformat": 4, + "nbformat_minor": 0 +} \ No newline at end of file